Kepekaan haMRSA (staphylococcus resisten-methicillin dari rumah sakit) dan caMRSA (staphylococcus resisten-methicillin dari lingkungan) terhadap des-F(6)-kuinolon DX-619

Thursday, November 19, 2009

Abstrak

Tujuan: Tujuan  penelitian ini adalah untuk menguji aktivitas des-F(6)-kuinolon DX-619 terbaru terhadap staphylococcus resisten-methicillin (MRS) yang diisolasi di rumah sakit dan lingkungan masyarakat dan untuk membandingkan aktivitasnya dengan kuinolon-kuinolon lain, sitafloksasin dan levofloksasin, serta antibiotik-antibiotik lain yang digunakan untuk pengobatan infeksi Staphylococcus aureus yang resisten methicillin, termasuk vankomisin, teicoplanin, arbekacin, linezolid dan kuinurpistin/dalfopristin.

Metode: MIC ditentukan dengan metode dilusi agar dengan menggunakan MRS dari rumah-sakit (S. aureus yang mencakup turunan-turunan dengan kepekaan yang berkurang terhadap vankomisin, 103; staphylococcus negatif-koagulase, 87) dan MRS dari komunitas (S. aureus yang mencakup turunan-turunan yang resisten oksasilin non-multiresisten, 37; staphylococcus negatif-koagulase, 92). Daerah-daerah penentu resistensi kuinolon pada gen gyrA, gyrB, grIA dan grIB dari enam turunan yang kepekaannya berkurang terhadap DX-619. Diurutkan.

Hasil: DX-619 menunjukkan nilai MIC90 terendah untuk semua kategori turunan bakteri yang diuji, tanpa tergantung pada derajat resistensi glikopeptida. Keenam turunan dengan nilai MIC >128 mg/dL levofloksasin umumnya membawa dua mutasi dalam gyrA dan dua mutasi dalam gfIA. DX-619 menunjukkan aktivitas kuat terhadap turunan-turunan yang memiliki nilai MIC 2 mg/L.

Kesimpulan: DX-619 cukup kuat terhadap semua MSR yang diuji, sehingga menandakan bahwa ini akan menjadi kandidat yang menjanjikan untuk pengobatan infeksi S. aureus yang resisten methicillin jika konsentrasi in vivo yang cukup dapat dicapai dengan aman.

Kata kunci: Staphylococcus aureus, staphylococcus negatif-koagulase, aktivitas antimikroba, gyrA, grIA.


Pendahuluan

Staphylococcus yang resisten methicillin (MRS) telah menjadi  patogen nosokomial utama di seluruh dunia. Turunan-turunan staphylococcus umumnya resisten terhadap kebanyakan agen antimikroba yang tersedia secara klinis dan sangat resisten terhadap β-laktam. Glikopeptida, vankomisin dan teicoplanin, telah digunakan untuk pengobatan infeksi yang disebabkan oleh MRS yang multi-resisten ini. Akan tetapi, kepekaan MRS terhadap glikopeptida telah mengalami perubahan. Turunan S. aureus intermediet-vankomisin (VISA) atau turunan S. aureus intermediet-glikopeptida dan turunan MRSA yang resisten vankomisin, telah dilaporkan. Sebuah antibiotik oksazolidinon, linezolid, telah diperkenalkan sebagai sebuah agen terapeutik baru. Akan tetapi, S. aureus yang resisten-linezolid pertama kali muncul pada tahun 2001. Pengembangan agen-agen antistaphylococcal terbaru telah dilakukan.

DX-619 dibuat sebagai obat yang akan digunakan untuk pengobatan infeksi yang disebabkan oleh organisme Gram-positif yang resisten banyak obat. Dalam penelitian ini, kami menguji aktivitas DX-16 secara in vitro yang dibandingkan dengan tujuh senyawa referensi. Karena epidemiologi MRS telah mengalami perubahan dan MRS telah sering diisolasi dari infeksi dari lingkungan masyarakat, maka kami menguji kepekaan isolat-isolat baik yang didapat dari rumah sakit maupun dari lingkungan terhadap DX-619.

Bahan dan metode

DX-619, sitafloksasin dan levofloksasin disediakan oleh Daiichi Sankyo Co. Ltd, Tokyo, Jepang. Vancomycin dibeli dari Sigma Chemical Co., St Louis, MO, USA. Teicoplanin dan kuinupristin/dalfopristin disuplai oleh Aventis Pharma Ltd, Strasbourg, Perancis. Arbekacin disuplai oleh Meiji Seika Kaisha, Tokyo, Kepang. Linezolid disuplai oleh Pfizer, New York, USA.

Turunan-turunan bakteri yang diteliti adalah sebagai berikut: 103 turunan MRSA dari rumah sakit (HA-MRSA), yang dikelompokkan menjadi dua kategori, 80 turunan MRSA peka vankomisin [65 dari 11 negara Asia (Jepang, Korea, Cina, Thailand, India, Indonesia, Filipina, Saudi Arabia, Singapura, Sri Lanka dan Vietnam) yang diisolasi pada tahun 1996 dan 4 turunan tipe untuk typing SCCmec, NCTC 10442, N315, MRSA dan 85/2082] dan 23 turunan MRSA dengan kepekaan yang berkurang terhadap vankomisin [diisolasi sebagai VISA dari 7 negara (Jepang, USA, Korea Selatan, Inggris, Perancis, Brazil, dan Taiwan) pada tahun 1996-2002]; 37 MRSA dari lingkungan komunitas (CA-MRSA)/turunan S. aureus resisten oksasilin non-multiresisten (NORSA) (25 turunan CA-MRSA yang diisolasi dari USA dan Australia dan 12 turunan NORSA yang diisolasi dari Australia); 87 turunan staphylococcus negatif koagulase-resisten-methicillin dari-rumah-sakit (HA-MRCoNS) (21 dari Juntendo Hospital pada tahun 2002 dan 66 dari Tokyo University Hospital di Jepang pada tahun 2002-03) [Staphylococcus auricularis (n = 3), Staphylococcus capitis (n = 12), Staphylococcus haemolyticus (n = 3), Staphylococcus (n = 3), Staphylococcus hominis (n = 10) dan Staphylococcus warneri (n = 1)]; 92 turunan staphylococcus negatif-koagulase resisten-methicillin dari-komunitas (CA-MRCoNS) diisolasi dari bayi-bayi taman kanak-kanak Jepang atau sekolah perawatan di tahun 2001-02 [S. auricularis (n = 1), S. caprae (n = 3), Staphylococcus cohnii (n = 2), S. epidermidis (n = 43), S. haemolyticus (n = 1)]. Semua turunan yang diuji membawa mecA, yang dikonfirmasi dengan PCR seperti dijelaskan sebelumnya.

MIC ditentukan dengan metode dilusi agar seperti dianjurkan oleh CLSI dengan menggunakan S. aureus FDA 209-P dan S. aureus ATCC 29213 sebagai turunan referensi.

Urutan-urutan nukleotida dari area penentu resistensi kuinolon (QRDR) dari gen gyrA, gyrB, grlA dan grlB pada enam turunan MRSA (empat dari Korea, JCS108, JCS116,. JCSC129 dan JCSC133, dan dua dari Jepang, JCS378 dan JCSC1111) dengan nilai MIC tertinggi (2 mg/L) dari DX-619 ditentukan dengan mengamplifikasi fragmen-fragmen DNA menggunakan PCR seperti disebutkan sebelumnya dengan pasangan-pasangan primer sebagai berikut: gyrA, gyrA-up, TGGCTGAATTACCTCAATCAAG dan gyrA-down, CTTCAATAACTGACAGAGAACG; gyrB, gyrB-up, ATACACGTG-AAGGTATGACAGC dan gyrB-down, TCCAAGACCTTTGTA-TCG-GCA; gyrA, grlA-up, TTAGGTGATCGCTTTGGAAGAT dan grlA-down, TACCTGTAGAACCATTCACTAG dan grlB, grlB-up, ACTTCTGAAGCTA-GAAGTGCTG dan grlB-down, TTCTGGGTTCATCGTCGTTTC. Sekuensing nukleotida dilakukan dengan menggunakan BigDye terminator versi 3.1 Cycle Sequencing Kit (Applied Biosystems, CA, USA) dan 3730 DNA Analyzer (Applied Biosystems and Hitachi, Ltd, Tokyo Jepang), menurut instruksi pabrik.

Hasil dan Pembahasan

Kami menguji aktivitas in vitro DX-619 dan tujuh senyawa referensi terhadap jenis-jenis MRS berbeda (Tabel 1). Untuk turunan HA-MRSA yang peka vankomisin, poporsi turunan yang peka terhadap empat antibiotik, vankomisin, teikoplanin, linezolid dan kuinupristin/dalfopristin, dinilai sebesar ≥98,8% berdasarkan kriteria CLSI, tetapi hanya 21,3% turunan yang peka terhadap levofloksasin (Tabel 1B). Linezolid dan kuinupristin/dalfopristin efektif terhadap turunan VISA yang menunjukkan penurunan kepekaan terhadap vankomisin (MIC = 2-8 mg/L) dan teicoplanin (MIC = 4-32 mg/L) (Tabel 1C). Semua turunan ini resisten terhadap levofloksasin. DX-619 menunjukkan nilai MIC50 dan MIC90 yang paling rendah (0,06 dan 0,25 mg/L) untuk 103 turunan HA-MRSA, tanpa tergantung pada kepekaan terhadap glikopeptida (Tabel 1A).

Turunan-turunan CA-MRSA/NORSA peka terhadap kedelapan senyawa yang diuji (Tabel 1D).

Kepekaan turunan-turunan MRCoNS mirip dengan MRSA (Tabel 1E-J). Nilai MIC50 dan MIC90 dari DX-619 untuk turunan HA-MRCoNS dan CA-MRCoNS sangat rendah. Nilai MIC90 untuk turunan HA-MRCoNS dari delapan antibiotik sama dengan atau 2-8 kali lipat lebih rendah dari turunan HA-MRSA. Levofloksasin tidak sama efektif terhadap HA-MRCoNS dan terhadap HA-MRSA. Beberapa turunan HA-MRCoNS (S. capitis dan S. auricularis) menunjukkan nilai MIC levofloksasin ≥64 mg/L. Hampir semua turunan CA-MRCoNS peka terhadap kedelapan senyawa yang diuji. Akan tetapi, 5,4% diantaranya resisten terhadap teicoplanin dan 12% terhadap levofloksasin. Diantara senyawa yang diuji, DX-619 juga menunjukkan aktivitas tertinggi terhadap semua MRCoNS yang diuji.

Telah diketahui bahwa resisten kuinolon bisa terjadi sebagai akibat dari mutasi pada guras DNA dan topoisomerase IV, yang merupakan target untuk kelompok antimikroba ini. Diantara turunan-turunan yang diuji, enam turunan HA-MRSA menunjukkan nilai MIC 2 mg/L dari DX-619, yang merupakan nilai tertinggi yang dilaporkan dari isolat-isolat staphylococcus klinis sebelumnya. Turunan-turunan ini sangat resisten terhadap kuinolon lain yang diuji dengan nilai MIC 32 mg/L untuk sitafloksasin dan >128 mg/L untuk levofloksasin. Untuk menentukan basis molekuler untuk resistensi kuinolon pada turunan-turunan ini, kami menentukan sekuensi nukleotida dari QRDR dari gyrAB dan grlAB dari enam turunan ini. Menariknya, keenam turunan yang diisolasi dari dua negara, Korea dan Jepang, memiliki mutasi identik dalam gen gyrA dan grlA, sedangkan tidak ada mutasi yang ditemukan pada QRDR gen gyrB dan grlB. Keempat mutasi terletak pada domain α4 dari GyrA dan GrlA; pada GyrA, di kodon 84 Ser (TCA) menjadi Leu (TTA) dan pada kodon 85 Ser (TCT) menjadi Pro (CCT); dan pada GrlA, di kodon 80 Ser (TCC) menjadi Phe (TTC) dan pada kodon 84 Glu (GAA) menjadi Lys (GAA).

Des-F(6)-kuinolon DX-619 menunjukkan nilai MIC yang sangat rendah untuk dua turunan S. aureus referensi. FDA 209-P dan ATCC 29213, dengan MIC 0,008 dan 0,016 mg/L, masing-masing. Walaupun nilai MIC untuk isolat-isolat klinis meningkat hampir 32-kali lipat, namun masih kuat terhadap semua kategori MRS termasuk turunan-turunan yang resisten terhadap kuinolon yang tersedia secara klinis dengan nilai MIC berkisar antara 0,008 sampai 2 mg/L. Aktivitas yang baik ini bisa menjadi fungsi afinitas tinggi untuk enzim target dan/atau struktur yang mendukung untuk akumulasi dalam sel.

DX-619 bisa menjadi alternatif yang bermanfaat untuk pengobatan infeksi MRS. Penelitian-penelitian sebelumnya oleh Daiichi Sankyo Co. Ltd telah menunjukkan bahwa DX-619 memiliki profil keamanan yang menjanjikan. Penelitian lebih lanjut tentang toksisitas, farmakokinetika dan farmakodinamika DX-619 diperlukan.

0 comments:

Post a Comment

BlueDEX Ads
 
Bloggerized by Blogger Template